An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT004092.1

General info


NONCODE TRANSCRIPT IDNONHSAT004092.1
NONCODE Gene IDNONHSAG001891.1
Chromosomechr1
Start Site79786812
End Site79787278
Strand-
Exon Number2
CNCI Score-0.7119978
Length254
Assemblyhg19
Other transcript VersionsNONHSAT004092.2

Sequence


>NONHSAT004092.1
ATTTCTGCTTGTAACAGCAACTCATTTTTAGCGAGAAATAATTGAATAAGCTCAAAGACCCTAAGATCGGGGTGCTGAGAAGAGCCCAGGCAGCACAACATGAGGACAGTGCTTTTCTTATAAGAAAAGGGAAGAGATAAAAAAGATGGACAGAAAACAACATAGATGATTTGGCAAAATGAGATAGAGGAGGAACTGTCTTCCATATGGGGATATACCAGTGAAGTCAGACCACATTAACAGCAACAAAAATC

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT004092
noncodeV3n364135
PMID26117828PNCT_HSA133351
PMID26117828TCONS_00002576
noncodeV3Human
lncipedialnc-ELTD1-4-1_dup1