An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT004579.1

General info


NONCODE TRANSCRIPT IDNONHSAT004579.1
NONCODE Gene IDNONHSAG002118.1
Chromosomechr1
Start Site94715930
End Site94800394
Strand+
Exon Number3
CNCI Score-0.0715067
Length598
Assemblyhg19
Other transcript VersionsNONHSAT004579.2

Sequence


>NONHSAT004579.1
TTAGATTCTCCTCAACCATGATGAATAATGCCTGGGAGAGGGGAAGAAGTAATGGAAGCCTGCACGGGTGGCCCCAAGGCAGGCAGTCCTTGGACTCCCTGGACTGCGGCTGTCCTTGACCTCACTGCTGGGGCATGTAAAAGGAACGACTCAGAGTCTAACAGGCCACAGTCTGGGCTTGATGTTCACCGATTTTCCCTCAGCTCCGACTGTGGCTCCTCTCAGCTGACTCTGACCCTGCTCTCAGCCGGGCTGCATCTGCCCATCTCAGCACATCAATAAACAGCAGAGGGAAACTACCACCTTGGAAGGAGCCAGGCAGTTTCTGCTGGGTAGGCCGCAGCCTGGAACATGGAAGTAGCTTCTTCCATCCTACACTGGAAACCACCCAGCATCCCGGGCCCTCCAGAGAAGAGCCAGACTCCCTTCCCTGGGAAGAGACTATAGTCCTATCTGTATCCTCCGTGGTCATTGCCCCTCAGTCACAGCAATGAAGAGCAAATTACCTGTTTTCTGTATGTTCCTCTGACAACAACTGCCACAGAGTAAATATGAAAGGTTCTGGATGATTCCTTGTCAGCTTTTATTAAAATTCCAC

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT004580.1
NONHSAT004583.1
NONHSAT004584.1
NONHSAT004587.1
NONHSAT004588.1
NONHSAT149370.1

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA004379
NONCODEv4NONHSAT004579
PMID26117828TCONS_00001434
lncipedialnc-ABCD3-2-5_dup1