An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT004994.2

General info


NONCODE TRANSCRIPT IDNONHSAT004994.2
NONCODE Gene IDNONHSAG002312.2
Chromosomechr1
Start Site108734255
End Site108736272
Strand-
Exon Number3
CNCI Score-0.0344064
Length444
Assemblyhg38
Other transcript VersionsNONHSAT004994.1(old version)

Sequence


>NONHSAT004994.2
TTCCGGGCAAAGAGAAGAGCACTGCAGTAGCTCCAGAACATGACATAGAATAGGAGGGGCTATGCTTTGGGCCAGCTTGTCCTGTGGACCAAATAATGGAAAAACAAGGAATCAGAGCATGACAGCCAGGGACAATGAGAACAGCCCCTTGGGAGGAACTGTCCTCCTTCCATCACCAAGGGCCATCCTGAACCTCCTGTCACCTACATATCATTCAAAATTTTAGATTCTGGCTATCAGAATACATGAAAAATATATGACTGTGCCCTGGGCAAGGTAGCAGAAGGTGCTGGAACACAGAGCGGAGAATTGCTAATGTTTTCCTGCCAGCTCTGGTGAGATGGTAGTTGCTGACAGCCATGCTTTGTGATCACAGATTGTCTGCCCACTCATATTGCCAAGCCTAGCTTGTGATTTATAAATTTATTTTTTCTGATCCTCTAA

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
00000.04298450
foreskinheartheart_RHLF_1HLF_2kidney
000.589333000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
007.30582014.8158
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
8.243960017.33810
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
NONCODEv4NONHSAT004994
PMID26117828PNCT_HSA004811
lncipedialnc-HENMT1-1-1_dup1
PMID26117828TCONS_00000901