An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT007044.1

General info


NONCODE TRANSCRIPT IDNONHSAT007044.1
NONCODE Gene IDNONHSAG003206.2
Chromosomechr1
Start Site160171679
End Site160174194
Strand+
Exon Number3
CNCI Score-0.0942080
Length297
Assemblyhg38
Other transcript VersionsNONHSAT007044.1(old version)

Sequence


>NONHSAT007044.1
GGCCTCATATCCATGATTGACCCTCCCCGAGCTGCAGTGCCTGATGCTGTGAGCAAGTGTCGCAGTGCAGGAATTAAGTGATCATGGTAACAGGAGATCATCCCATTACAGCTAAGGCCATTGCCAAGGGTGTGGGCATCATCTCAGAAGGCACTGAGACGGCAGAGGAAGTCGCTGCCCGGCTTAAGATCCCTATCAGCAAGGTCGATGCCAGGCTGCCAAAGCCATTGTGGTGCATGGTGCAGAACTGAAGGACATACAGTCCAAGCAGCTTGATCAGATCCTCCAGAACCACCC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-CASQ1-1-1
NONCODEv4NONHSAT007044
noncodeV3n333209
PMID26117828PNCT_HSA137391