An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT007194.1

General info


NONCODE TRANSCRIPT IDNONHSAT007194.1
NONCODE Gene IDNONHSAG003271.2
Chromosomechr1
Start Site161617991
End Site161619585
Strand-
Exon Number3
CNCI Score-0.0081920
Length438
Assemblyhg38
Other transcript VersionsNONHSAT007194.1(old version)

Sequence


>NONHSAT007194.1
ATGGGCAAGTGTCATGGACTGTCTACCTCCAGGAAGCTCCATTGTCACCGACAGGATCAGAAGTGGCATGGTAAATGGTACAAGAAAGCCCATTCGGGCACAGTCCTGAAGACCAGCCCTTTTGGAGGTGCTTCTCATGCAAAGGGAATTGGGCTGGAAAAAGTAGGGATTGGAGCCAAATAGCCCAGCTCTGCCACTGAGAAGTGTTGGAGGCTGTGAGGCAGATGAGAGAACAGCAAGAAAATCACAGCCTTTGTACCTGATGATGATTGCTTGAATTTTATTGAAAAAAATGATGAAGTTCTTTCTGGTTGCTGGATTTGGCAGAAAAGGTCATGCTGTTGGTGATATTCCTGGAGTCCACCTTAAAGTTGTTAAAGTAGCCAATGTCTCTCTTTTGGCCCTATCAAAAGCAAGGAGGAAAGACCAAGCTCATCA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT007194
ensemblENST00000448848
PMID26117828PNCT_HSA006803
lncipedialnc-FCGR3B-5-1_dup1