An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT007861.1

General info


NONCODE TRANSCRIPT IDNONHSAT007861.1
NONCODE Gene IDNONHSAG003597.2
Chromosomechr1
Start Site179447577
End Site179448440
Strand-
Exon Number1
CNCI Score-0.0339968
Length863
Assemblyhg38
Other transcript VersionsNONHSAT007861.1(old version)

Sequence


>NONHSAT007861.1
ATGGTGCAGAAGAAAATACAAATCACATGCATAATGGATGAAAGGAACTGAGAGGCCACTTTTACAAAGAGAGAGTTTGGATTAATGAAGAAAGCCTATGAACTTAGTGTGCTCTATGACTGTGCATTTTCAACAGCTCTAACAAACTCTTTCAATATGCTAGCACTGATATGGACAAAGTTCTTCTCAAGTATACAGAATATAATTAACCTTATGAAAGCACAACCAGCTCAGATATTGTTGAGGCTCTGAACAAGAAGGAACACAGAGGGTGCGACAGCTCAGACCCTGATACTTCATGTGTGCTAACTCCATATACAGAAGAAAAATAATTAATGAGGAATTTGATAATATGATGCAGAATCATAACATTGCACCTGGTTTGCCACCTCAGAATTTTTCAATGTCTGTCACAGTTCCAGTGAAAAGCCCCAATGCTTTGTCCTACACTAACCCAGGGAGTTCACTGGTGTCACCATCTTTGGCAGCCAGCTCAACGTTAACAGATTTAAACACGCTCTCTCCACCTCAAACCATATTACATAGAAATGTGTCCCCTGGAGCTCCTCAGAGACCACCAAGTACTGGCAATGCAGGTGGGATGTTGGGCACTACAGACTTCACAGTGCCAAATGGAACTGGAAGCAGCCCAGTGGGGAATGAATTTGTAAACTCAAGAGCTTCTCCAAATTTGATTGGAGCTACTGGTGCAAATAGTTTAGGTAAAGTCATGCCTACAAAGTCTCCCCCTCCACCAGGTGGCAGTAATCTTGGAATGAACAGTGGAAAACCAGATCTTCGAGTTGTCATCCCCGCTTCAAGCAAGGGCATGACACCTCCACTAGTAAGTTGAACCTTTCTTC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT007861
lncipedialnc-NPHS2-5-1_dup1
ensemblENST00000454867