An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT010629.2

General info


NONCODE TRANSCRIPT IDNONHSAT010629.2
NONCODE Gene IDNONHSAG004847.2
Chromosomechr1
Start Site243966078
End Site243979476
Strand-
Exon Number2
CNCI Score-0.1556480
Length365
Assemblyhg38
Other transcript VersionsNONHSAT010629.1(old version)

Sequence


>NONHSAT010629.2
TGGGAATCCCCACAAAATGAGAATGAGGGGATTGAAAGTGTTTTTGTTCGAAGAGCTCTGGCATGGAGGCCACAGTCCTTCCATGAAATGTAACAAAGCGGGGCAGTTCACTCCTGAACACTTACCCGCACTGTACAGCAGAAGCTGCTTGGGATGAGCGACTGCTACAGGAGGAAAATGAAGTAGGAAACTACATAAAAATCCAGCTTTCCTGTGAGTATAAAAAAGGAAGAAAAGGGTTATAGACAAGAGATGCCCGAGAGAGACAAGAATTATGAAGACAACCAAATGTTCTCTATCAGGTAAGCTGAAAACAGATTGTAGAAAACTTTTGACACCAAACTTTCCTGGAACCCTGAAGCAAG

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000000
foreskinheartheart_RHLF_1HLF_2kidney
00.09248010000
liverliver_RlunglymphNodeovaryplacenta_R
00003.17967e-060
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0005.58721e-0700
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT153263.1

Data Sources


Source NameOld Id
PMID26117828PNCT_HSA141374
noncodeV3n364311
NONCODEv4NONHSAT010629
lncipedialnc-AKT3-1-1_dup1
PMID26117828TCONS_00002796
noncodeV3Human