An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT010720.1

General info


NONCODE TRANSCRIPT IDNONHSAT010720.1
NONCODE Gene IDNONHSAG004900.1
Chromosomechr1
Start Site246918812
End Site246919134
Strand-
Exon Number1
CNCI Score-0.3284274
Length322
Assemblyhg19
Other transcript VersionsNONHSAT010720.2

Sequence


>NONHSAT010720.1
ATGCCTGGAAAGCTGTGGTCCAAGGCCGTTTTTGCCGTCAGCAGGATCTCCAGAACCAAAGGGAGGACACAGCTCTTCTTAAAACTGAAGGTATTTATGGCTGACATAAAATGAGATTTGATTTGGGCAGGAAATGCGCTTATGTGTACAAAGAATAATACTGACTCCTGGCAGCAAACCAAACAAAACCAGAGTAAGGTGGAGAAAGGTAACGTGTGCCCACGGAAACAGTGGCACAATGTGTGCCTAATTCCAAAGCAGCCGTCCTGCTTAGGCCACTAGTCACGGCGGCTCTGTGATGCTGTACTCCTCAAGGATTTGA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-RP11-439E19.8.1-1-1_d
ensemblENST00000413092
NONCODEv4NONHSAT010720