An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT010720.2

General info


NONCODE TRANSCRIPT IDNONHSAT010720.2
NONCODE Gene IDNONHSAG004900.2
Chromosomechr1
Start Site246755510
End Site246755832
Strand-
Exon Number1
CNCI Score-0.1310720
Length322
Assemblyhg38
Other transcript VersionsNONHSAT010720.1(old version)

Sequence


>NONHSAT010720.2
ATGCCTGGAAAGCTGTGGTCCAAGGCCGTTTTTGCCGTCAGCAGGATCTCCAGAACCAAAGGGAGGACACAGCTCTTCTTAAAACTGAAGGTATTTATGGCTGACATAAAATGAGATTTGATTTGGGCAGGAAATGCGCTTATGTGTACAAAGAATAATACTGACTCCTGGCAGCAAACCAAACAAAACCAGAGTAAGGTGGAGAAAGGTAACGTGTGCCCACGGAAACAGTGGCACAATGTGTGCCTAATTCCAAAGCAGCCGTCCTGCTTAGGCCACTAGTCACGGCGGCTCTGTGATGCTGTACTCCTCAAGGATTTGA

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
0000000.6251250.113669
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000.18498000.396932
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
04.1955408.815412.4523
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
4.533120015.94760
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset