An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT010824.2

General info


NONCODE TRANSCRIPT IDNONHSAT010824.2
NONCODE Gene IDNONHSAG004945.2
Chromosomechr1
Start Site248810093
End Site248810342
Strand+
Exon Number1
CNCI Score-0.0131072
Length249
Assemblyhg38
Other transcript VersionsNONHSAT010824.1(old version)

Sequence


>NONHSAT010824.2
AGATCCCAACCCTCTGGCACTCTCATCTCTTAGCTCAGACAGAGCCCACTCCACCCCGCAGGCCCCTTTCTACCAAACCCTCTCCTGGCACCCATCACCTCACACAGCATGGCCCCATGAGGCACCAACTCCTCCCCTGCTTCTCTACACTTGCCCTGTACATGACCACCCTGGCCATGGGGCCTTCCACCCCCGCAAGAGCATGCATAGCGCAGCTCACTCAATCTGGTCCTTCACCTCCCTTCCCTG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
03.184481.7520900000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000000.199906
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
07.6144313.02724.1927216.103
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
27.82260025.75110
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-ZNF672-3-1_dup1
PMID23818866FPKM1_group_2742_transcri
NONCODEv4NONHSAT010824