An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT011052.1

General info


NONCODE TRANSCRIPT IDNONHSAT011052.1
NONCODE Gene IDNONHSAG005046.1
Chromosomechr10
Start Site3810106
End Site3810943
Strand+
Exon Number2
CNCI Score-0.0658641
Length313
Assemblyhg19
Other transcript VersionsNONHSAT011052.2

Sequence


>NONHSAT011052.1
AATGGCCCTGGTGACTTCTTACCTGATTCATCCCACACCAGTCAGAAGGGGCTGTGAAGGCAGCAGCGAAGGAGCCACACATGGACGTGGAATGGGCACGCTGACCATCATGGTCACGACTGCAAGAAAGCAGGGCTGCGTGGGTTAATTGGCTGTGTCTGAGGGTCACCCCTGCACAAGGAGGATGATGACGACTGCCCTGTGCAACCCTGGGTCATCTCAGGGGAGAGCCATTCCCAGGTTCACAGCAAGCACTCTTTTACTCAGATGGGCCACCTGCATCAGGCCCCAAGGAAGCACTTATTAGTAGAAG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
noncodeV3n371725
noncodeV3Human
gencodeENST00000415358.1
PMID26117828PNCT_HSA141722
ensemblENST00000415358
PMID26117828TCONS_00003465
lncipedialnc-PFKP-13-1_dup1
NONCODEv4NONHSAT011052