An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT011085.1

General info


NONCODE TRANSCRIPT IDNONHSAT011085.1
NONCODE Gene IDNONHSAG005063.1
Chromosomechr10
Start Site4284528
End Site4284775
Strand-
Exon Number1
CNCI Score-0.6353718
Length247
Assemblyhg19
Other transcript VersionsNONHSAT011085.2

Sequence


>NONHSAT011085.1
AAGTCCTGTTGACAAAAGAGAATAATACAGGTGTCCTCCTGAAACTGTCACCACAGTGACCTTCCTCAGTCAAAAAGAAATATAAATATTATTGTGTTTCTCGTGTCTGAGGCACCTCTGAAAGCATTTATCTTTTCAGAGAGTTCAGCACTTCATCTCACGGGTTAATTAAACCAACCTGTAGTGGCAAAGTTTAGTGGTAGTGAAAATAAACATAATCCTCTTTCTGTTGCCCAACCTTTCAGTT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT011086.1

Data Sources

Source NameOld Id
noncodeV3n334561