An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT011142.1

General info


NONCODE TRANSCRIPT IDNONHSAT011142.1
NONCODE Gene IDNONHSAG005089.1
Chromosomechr10
Start Site5249131
End Site5249705
Strand+
Exon Number1
CNCI Score-0.1600224
Length574
Assemblyhg19
Other transcript VersionsNONHSAT011142.2

Sequence


>NONHSAT011142.1
GGGAATGGGCTAACTGGCTAAACTACTATCTTGTCCATCCTGCCTTCACTTCAGTCCTTCCACATTGTTATTTGGTGTTTGAACTGTGCTAGAAGAACTGTTTTATACAGGCTGCTATTCAATAAATTTGTAAATACCATACCCACACCAAAGGATTTAACACTGAAAAGATTAAGGTAATTTTGGAAAATTCTAAAAGTCACTTTTCACTCCTGAGATGTAGGTGGTCAGAAGAAATGAGGAACACTGTAGAAGCCATATGCAAGATGCACAGATGGCATTGTGTTTGTTGTGGACTGTTGATGTTAACAGGATGGAAGAAGTCAAAACTGAACTTTATAAAATAGGGTATAAGAAAATAAAGATGTCCCTGTACTTACAGGTGCTAAGAAACTAGACTTGAAGAACTTGTCTCTCTCAGAAATTGAGAAATTGTTAGCAATGGTTGAACTAAGCTCATCAACTCCTTGGCATTTGCAGCCTACCTGTGCAATCATAGGACATGAAATAAAGGAAGGACTTGAGAAACTCCATGATGTGATAATGAAGAGAAAAATATTGCAGTAATATAAAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000441452
lncipedialnc-AKR1C3-5-1_dup1
NONCODEv4NONHSAT011142