An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT011590.1

General info


NONCODE TRANSCRIPT IDNONHSAT011590.1
NONCODE Gene IDNONHSAG005312.1
Chromosomechr10
Start Site16320699
End Site16337857
Strand+
Exon Number4
CNCI Score-0.0888875
Length458
Assemblyhg19
Other transcript VersionsNONHSAT011590.2

Sequence


>NONHSAT011590.1
GGCCTAACTTATGTGTCATGCAAAGGATGGCTCTTGGAAAAATGCAAAGAAGCAGGGGCCGCTAAGGGAGAGATGTGAAGGTCAAGGAAGCTCTGAGCTCCTGACAGCCGCCCTTCCAGCCTTCTCCTGCCTTCCATAGAGAGATGCTATGGACTCTTGGTCCAGAGACTCAAATTCAAGGAAAAGAAGAGGCAACATTTGCAGTGTTGATCCTTGAGTTGAACAAAGAGTGGTCAGGAGAAGAAACCAACAAGAAATGTAACCTACCTCCAGAACTCAGGAACTCAGCAAATTCTCCCAGATTGTGATACCTCATTTCTGAGGACTTCATCTTTACCAAATCTTTCAATCCAAAGCAAACGAATACTGAAAATTCATGTATCCAAAGCAAATGAATACTGAACATTCACGTTGAGATGATCTTTAAATGTAATTAAATAGAGATAATGTAACTAAAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT011591.1

Data Sources

Source NameOld Id
PMID26117828TCONS_00003504
noncodeV3Human
NONCODEv4NONHSAT011590
lncipedialnc-PTER-2-1_dup1
gencodeENST00000417542.1
noncodeV3n371745
ensemblENST00000417542
PMID26117828PNCT_HSA142397