An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT011591.1

General info


NONCODE TRANSCRIPT IDNONHSAT011591.1
NONCODE Gene IDNONHSAG005312.1
Chromosomechr10
Start Site16320699
End Site16331047
Strand+
Exon Number3
CNCI Score-0.0888875
Length435
Assemblyhg19
Other transcript VersionsNONHSAT011591.2

Sequence


>NONHSAT011591.1
GGCCTAACTTATGTGTCATGCAAAGGATGGCTCTTGGAAAAATGCAAAGAAGCAGGGGCCGCTAAGGGAGAGATGTGAAGGTCAAGGAAGCTCTGAGCTCCTGACAGCCGCCCTTCCAGCCTTCTCCTGCCTTCCATAGAGAGATGCTATGGACTCTTGGTCCAGAGACTCAAATTCAAGGAAAAGAAGAGGCAACATTTGCAGTGTTGATCCTTGAGTTGAACAAAGAGTGGTCAGGAGAAGAAACCAACAAGAAATGTAACCTACCTCCAGAACTCAGGAACTCAGGTACCCTTAAGGATATCAGAAACAATGAAATATGGATTGGCAGAAGCATCTTCACCACCATCTTCAGATGTAATTAATGCAGCTGTTGAATTTGGTTGACTATCCACCTATAATTACCACATTGCCCATTACAGATTTTTGCTGCCT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT011590.1

Data Sources

Source NameOld Id
NONCODEv4NONHSAT011591
lncipedialnc-PTER-2-2_dup1
ensemblENST00000434386
PMID26117828PNCT_HSA142398
noncodeV3n371744
PMID26117828TCONS_00003503
noncodeV3Human
gencodeENST00000434386.4