An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT012519.1

General info


NONCODE TRANSCRIPT IDNONHSAT012519.1
NONCODE Gene IDNONHSAG005499.1
Chromosomechr10
Start Site29698464
End Site29776785
Strand+
Exon Number3
CNCI Score-0.1831409
Length881
Assemblyhg19
Other transcript VersionsNONHSAT012519.2

Sequence


>NONHSAT012519.1
GCACATGCGCGGCAGCTCCCGCTGCTGAATAGCTGAGAGGCGCACCCGGGCGGCCAGCTGGGCTCGGAGTGCAGCGGGGTTAGGATGGACGAGGACGTGTTGCACCCTGAAGAGCCTCATCATCGCCTGCTCTTGAGGTTCACAGATGATACCTTTGATCCAGAACTTGCAGCAACAATAGGTACCAACCTTCGCCTTTTCTATGACGTTTGCAAACTCTCCTACCCACAGGAAGCAGCAGTGGGGAGAGAGCAGGAGGAAGCAGTCCCCACTGTTGAGCGCCGAAGCTCGAGGTTCCACCAGCCTGGTCTGCACATGTCTTCTTCCTGAACACGAGGCAGACAGTCACCGTCTTTCCAGACAGAACGGGGATAGGACGCACCCCATATCGGAAGCATCCCTGCTGCGGACGCTTTCACTTCTAAAGAGTCTTGTCTGCTAATAAGAGTGCCCATGGCCCAGGGTGGCAGCAGGGGGATTTAGAAAGGGCATGATGATGGCACTAGCGGCTGCTTTCCTGGTTTGTGCTTTCCCAAATGTCACCCACTTCTCAGGACCATTATCAGTGTCATGTGCGTGGGTTAATGAAGGCTCCCCCTTCCAGGGAGATGAGCACACAGGCTCCTTTTCCCTCCTTCACTCTTCTCCCGGGGCCTTTCTCTCCCCTGGCCACCTCCTGCACCCAATTACATCTGTGGCCCAGGCAAGGGAAGCCACGCCTTCAGGAAGGGTCGGCTCTTCCCCTGGGGAGTTTCCACTATGAACCCTAGGGGCCTCTCAACAGGAAGGATGGAGGCGCCACCTTCTGTGGCTTTCAACACCTTTTCCTAAATATTTGTTGATTTTGAGCTTTCCACAATTAAACAGATCATGTAGTCTCTGG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT012518.1
NONHSAT012520.1
NONHSAT012521.1
NONHSAT012522.1
NONHSAT012523.1
NONHSAT012524.1
NONHSAT012525.1
NONHSAT012527.1
NONHSAT012528.1
NONHSAT012534.1
NONHSAT155291.1
NONHSAT155292.1
NONHSAT155293.1
NONHSAT155294.1
NONHSAT155295.1
NONHSAT155296.1

Data Sources


Source NameOld Id
noncodeV3n342590
PMID26117828TCONS_00003533
ensemblENST00000413405
lncipedialnc-LYZL1-3-20
refseqNR_110927
NAMESVIL-AS1
PMID26117828PNCT_HSA143591
gencodeENST00000413405.4
noncodeV3Human
NONCODEv4NONHSAT012519