An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT012693.1

General info


NONCODE TRANSCRIPT IDNONHSAT012693.1
NONCODE Gene IDNONHSAG005598.1
Chromosomechr10
Start Site34398517
End Site34399205
Strand-
Exon Number1
CNCI Score-0.4038994
Length688
Assemblyhg19
Other transcript VersionsNONHSAT012693.2

Sequence


>NONHSAT012693.1
CTTGTCAGGAAGGGCACAGAATGGGACAGAGATAAACCAGACAGTCATTTTGATCTGCTCTCTACGGTTTTTCAAGTCAGAGGCAATTGATGCTTGTCTAATGCATCCACACACTGCATGTCTGACTGGCGATGCCGCGCTCCTAAGTAGTTCTGCCATGAAACATAAAAGACAAAGGAAAAGCCGTTACACATCACACAGAGAACATTTTCGGGTCCCACAGCGGTGGTGGCAGGAAGCTCACTCTCGCGTCAGTATTAGAGTGTGTGTGTGGGTCTCGGGGATCTCGGTGGCTCCCATCTTCCTTCATTGTTCTGAACATCCTGTATTGTAAACCATGGCTGGGGTGCTAAAGTGCCTGTGAATCCCGATGTGGAAAAAGCTGGAGGTGAAAGCTCAGCATACCATGTATTTACTTTAAAAACAGAAAAAAAGACATGTATGGATATGTCTATTTTTTTTTTATTGGCACATTGTATTTTTGTGTTGACTTGTTTTTAGAAATGATGTGTCCACACACGTACCCGTGTCTCTTCTGCATTTCTGTGTCATGGTTCTGTTTCTTAATCACGTGCGGCGGTGTCTAAGTGGTGTTACCAGTGTACGCGCAGTGACCTTGGATGACAGTGGCTCTTTCTCACAGCCTCCCCTGAGCTGTGAGAAACAGCTTTCTCTGTACATATGCAAC

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
noncodeV3n381424
NONCODEv4NONHSAT012693
lncipedialnc-NRP1-8-1_dup1