An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT012762.1

General info


NONCODE TRANSCRIPT IDNONHSAT012762.1
NONCODE Gene IDNONHSAG005629.1
Chromosomechr10
Start Site37537045
End Site37604729
Strand+
Exon Number6
CNCI Score-0.1104066
Length540
Assemblyhg19
Other transcript VersionsNONHSAT012762.2

Sequence


>NONHSAT012762.1
ATTTTCACCGCTATGCCTCCTTTCACTCTGGGAGTCTTCCAGAGGTCTTGCACTCGGGAGAGCATGCTCAGGTTTCCCCAGCTCTACAAAATCACCCAGAATGCCAAAGACTTCAACACAAGGATACTGTGTTGACCAGTGGTCATGCCACTGCCTGTTGATTTGTTGAAAATATTGTTTACACGTATGTTCTTGTTACTGATTGTCAGAAAGCTGGTTTTGAGACTGCAGCTTGGACTAAATTCAGTCATCTGGCTGTCTGGGGAAGCATGCTGACCAGTCTGGTGTTCTTTGGCATCTACTCAGCCATCTGGTCCACCATTCTCATTGCCCCAAATATGAGAGGACAGCAACTGTGATCCTGAGCTGTGCACACTTCTGGTTGGGATTATTTCTGGTTTCTACTTCCTGTTTGAAGATGTGGCATGGAGAGTGCCAAGCACATCTGCAAAAAAGACATTGCTGGAGGAGGTGCAAAGAGCTGGAAACCAAGTCTCCAGTCCTGGGAAAAGCAGTGGTATGGAAAAGCAATGGAAAGAG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT012768.1
NONHSAT012769.1
NONHSAT012770.1
NONHSAT012772.1

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA012074
NONCODEv4NONHSAT012762
lncipedialnc-ANKRD30A-2-4
ensemblENST00000420453