An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT013336.2

General info


NONCODE TRANSCRIPT IDNONHSAT013336.2
NONCODE Gene IDNONHSAG005885.2
Chromosomechr10
Start Site49954213
End Site49954414
Strand+
Exon Number1
CNCI Score-0.0245760
Length201
Assemblyhg38
Other transcript VersionsNONHSAT013336.1(old version)

Sequence


>NONHSAT013336.2
TCCAGCAGTAGTCAGCTGTCTGGACAGAACCATTCCTGGGATGGTGTTACACTGCTGGGAGAAGAATGTCTTCTCTTCATCCAGTTGCCTCCATCACTGTTCTGGTGGTGTCTGGCACTGGTGCAAGGCAGAACTGTGCTTCCTTGAGAGTGTGCTGAGCATTCACCTTGGCTGCTTGGTTCTAGTCTGGGAGCAGACACA

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
09.581570000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
018.4544011.84779.93469
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
10.893009.582380
Loading...



Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
NONCODEv4NONHSAT013336
ensemblENST00000411250
lncipedialnc-MSMB-2-1_dup1