An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT015923.1

General info


NONCODE TRANSCRIPT IDNONHSAT015923.1
NONCODE Gene IDNONHSAG006661.1
Chromosomechr10
Start Site101369043
End Site101369286
Strand+
Exon Number1
CNCI Score-0.4222670
Length243
Assemblyhg19
Other transcript VersionsNONHSAT015923.2

Sequence


>NONHSAT015923.1
acaccaaatcccaaatactttttaattctcttacctccaggtctttgcctagaacataacccctcccctcttcaccaagttagctcatttgccttccaggtgtcacctcagatgttacttcctccaaatgtctaccctggtcacccaaggctacgctgggtatccttctgtcttctgagtatcctaggtttattctatcttctctcctgtcattttgttttgtaattgcctgtttccatgtat

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID23818866FPKM1_group_3806_transcri
NONCODEv4NONHSAT015923
lncipedialnc-ENTPD7-2-1_dup1