An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT017210.1

General info


NONCODE TRANSCRIPT IDNONHSAT017210.1
NONCODE Gene IDNONHSAG007292.2
Chromosomechr11
Start Site248764
End Site251939
Strand+
Exon Number5
CNCI Score-0.1638400
Length477
Assemblyhg38
Other transcript VersionsNONHSAT017210.1(old version)

Sequence


>NONHSAT017210.1
TGCTACCATAGTGTCTGAGCAGCAGGAGAGAGCCTTCACGCTGGGGCTAGCAGGACTTCTCGGCGAGGGAGTTTTTAACTTTGGAGAACTCTCATGCACCCTGTGCTGGAGTCCCTGAGGAATACTGACCGGCAGTGGCTGATTGACACCCTCTATGCCTTCAACAGTGGCAACGTAGAGCGGTTCCAGACTCTGAAGACTGCCTGGGGCCAGCAGCTGATTTAGCAGCTAATGAAGCCCAGCTTCTGAGGAAAATTCAGTTGTTGTGCCTCATGGAGTGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCACAGTGAATGAGTGGAGCTTCTGGTGATGAAGGCCCTTTCGGTGGGGCTGGTGAAAGGCAGTATAGACGAGGTGGACAAACGAGTCCACATGACCTGGGTGCAGCCCCGAGTGTTGGATTTGCAACAGGTG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT017210
lncipedialnc-NLRP6-1-2
noncodeV3n332978
PMID26117828PNCT_HSA149668