An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT017730.1

General info


NONCODE TRANSCRIPT IDNONHSAT017730.1
NONCODE Gene IDNONHSAG007533.2
Chromosomechr11
Start Site6488185
End Site6489377
Strand-
Exon Number2
CNCI Score-0.0995328
Length686
Assemblyhg38
Other transcript VersionsNONHSAT017730.1(old version)

Sequence


>NONHSAT017730.1
ATGGCTGTGCCACCCAAGTATGCCAATCTTGGCAAATCTGCCAGGAATGTCTTCAACAAGGGCTACGGATATGGCCTAATAAACCTTTTGAAAACAAAATCTGAGAATGCATTGGAATTTGAAAGCTTAGGCTCAGCCAACACTGAAATCACCAAAGTGACAGGCAGTCATGGAGACCAAGTACAGATGGACTGAGTACGGCCTGATGTTTATGAAGTGAAACACACAACACACCAGGACTGAGATTACTGTGGAAGATCATCTTGCAAGTGGACTGAAGCTGACCCTCAATTCACCCTTGTCACCTAATACTGGGGGAAAAATGCTAAAATCAACACCAGGTACAAGCAGGAGCACATCAACTTGGGCTGTAACCTGGATTTTGACATCACTGGACCTTCCATCTGGGGCGCTCTGGTGCTGGGTTACAAGGGTTGACTGGCTGGCTACCAGATAAATTTTGAGACTGCAAAATCCTGAGTGACCCAGAGCAACTCTGCAGTTGGTTACAAGTCTGATGAATTCCAACTTCACACTAACGTAAATAATGGGAGTGAACAACTCTAGCCTAACAGGTTTAGAATACACTGAGACCCTAAAGCCAGGTATCAAAATGACACTGTCAGCTCTCCTGGATGGCAAGAATAACAATGCCAGTGGTTACACGCTAGGTCTGGAACTGAAAT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-ARFIP2-2-1_dup1
ensemblENST00000524809
NONCODEv4NONHSAT017730
PMID26117828PNCT_HSA016039