An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT017872.1

General info


NONCODE TRANSCRIPT IDNONHSAT017872.1
NONCODE Gene IDNONHSAG007595.2
Chromosomechr11
Start Site8693356
End Site8696607
Strand+
Exon Number2
CNCI Score-0.0167936
Length744
Assemblyhg38
Other transcript VersionsNONHSAT017872.1(old version)

Sequence


>NONHSAT017872.1
GCCCAAACAACTGTACATTGTTTATTGAGAACACCCGTAGATGGGAAGGAGGGATGCCCTGTACCGCATCGTGGCCACCACTGACTGGGAGCCAGGCCCAGAGAGCACTGGCAGAGCTGGGGGTGGGCTTCCCATGACACACTGACCATCTCGGAGGGTGGGAGGAATGAGAGGACTAGGCCTAAGACCCTGGTGCCATGCTACAAATGGGGACTGATTGGCCTTTGCCTTTCAAAAACAGAGGGTATGGGTATGCGGACTACCAGCAAAAAATAGAAACTTGATTTTTTTAAAAGGTCCTCCTGTACATAACAAGACAGCATCTGCTCTCCAGGGCCCGGGACTGGCAGCGGGGACCTCAGGCAGGCAGGCAGGCCGAAGGCCTCCAGGGAAGATCAGTGGTTTGGCTGAGACAGTCAGCTGCACAAAACTGGCCAGTCACGAGCACCCAGCGAAACTTCATCCATGCTCTGGCAGGACAGGAAAGCACCCGGCCCCTTGGGAATATACAAATATTTGCCATATTCTCTTTGCTTGTTACAAAAAACAGTTAAGAAAGCTTACAGCAGATTATTTACAAACAGTATCCTGGGATATGATGAAGCCAGCAAACATCTGAGACTCCATAAAAACCTCAAGAAAGCGGCGGATGCTTTTGGAGGCCACAGATTTGCGGAAGGCCTCTCGCTGAAAGGCCCTCTCTCCCTTCTCACTCTGTGTCAGAAAGAGGGAGTAGTGCCCAAC

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
gencodeENST00000529883.1
PMID26117828TCONS_00005264
NONCODEv4NONHSAT017872
ensemblENST00000529883
PMID26117828PNCT_HSA016179
lncipedialnc-AKIP1-3-1