An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT018355.1

General info


NONCODE TRANSCRIPT IDNONHSAT018355.1
NONCODE Gene IDNONHSAG007830.1
Chromosomechr11
Start Site20000244
End Site20002883
Strand-
Exon Number2
CNCI Score-0.0966234
Length598
Assemblyhg19
Other transcript VersionsNONHSAT018355.2

Sequence


>NONHSAT018355.1
AGCCCAGCTACACCCGGGTGCAACGTGGATGTATCAGAAAACGACAACCCCAGAAAAGCGGGAAAGCCTCTGAGAAATGGGACTGAAATGGAACTGAACATATTTTTCAGAACACACCATTTCCTAGTCCTGTCTGAGTCATCCCAGACCTCTGGGAGCTGGCCAGACTTGAAGGGTAGTCCTCACCATCCCTCCAGTCAAGACAGACCTGTGAAGGCAACATGCCTTTTACAAAAGGAACTTTCTCTACAGAATAGGTTGGTAACTGACACTAGCTATGAAAAAGCTGTGGAATCTAACAGGACCTGCTAGAACAAATACTCCAGACTTCAAGTCTAACATTTAGTAAACAGATTTCTTCCCTTTCTTTAAATGTAATGATGCAACAATGTGGAACCAAGTGAAACTGGCTTTGTGAGTCACCTTCAGAAGCGGCGAAAGGTGGCTTCTCATTTCCAAAGTTCACAGTTCAACATGGCCTGCATAAGTAATACAAACTGACTGCCACTAATCTCACCAGAAATCACCTCTGTCAAGAACTGTGTGAGGAGAGAGGGGACAGAGAAGGAAAGAAATACGTACCGACTTGCTCTAGTCG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000534036
NONCODEv4NONHSAT018355
PMID26117828TCONS_00005703
PMID26117828PNCT_HSA016664
gencodeENST00000534036.1
lncipedialnc-DBX1-3-1_dup1