An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT021435.1

General info


NONCODE TRANSCRIPT IDNONHSAT021435.1
NONCODE Gene IDNONHSAG008361.2
Chromosomechr11
Start Site57700480
End Site57701157
Strand+
Exon Number1
CNCI Score-0.0573440
Length677
Assemblyhg38
Other transcript VersionsNONHSAT021435.1(old version)

Sequence


>NONHSAT021435.1
GGAGGGATACATATACGGAGGGGGATCTTACTCTTCCCATTCCTCAGACCAGCAGGAAAAGAGGGGAGACGTCAGTCTTTTTCCTGTGGTTCCCTCTCATTTGTCCCAGTTACTAACTACGGAAATAGCATCCTCTGCTGGTGCTAAGTGTGATTAGGAAGAAGCCTGGGGAGAGGTGAGTCTGGAATTTTGGTCACAAGAGGGAAGGACTTGGAGAGGAGAATTAGTTTTCTAGGCTCATTGGCATTTAGTTTCCCTAGGAAAGGGGTCAAAACTTCAAGACACTGGTGGTGGTGGGAGATCAGGAAAATAACTTGGCCTAGCTCAAACAATATTGGATAATCCCCTCCTTGGGGGAGAGGGATTAGAGTGTGCTCCTACTGGCCCCTTGGAGCCTCCCCTAGCTTACACAGTTAACTTGATTTTAAAATCCAAGGCCAGGAGAGAAGAATCCAAAAAGCAATATTTTTCATCACATGCCAAAAACGGGGGATAGAGAGAAGGAGTGGCAGGCCTAGGCCCCTCCGATTGTCCCTTGGGGGTTACCCCTCAGCCCACCTCACTATGGTGCTGGGTAGAGGGGATACCTGGGTTCTAACCTCTAAATAGGGGAGATCCCAGCCTCCACAAAGAGGCCCTTTTATTTTTTATTCTGATTAGCCATTTTAAACCAACGA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3n335669
NONCODEv4NONHSAT021435
lncipedialnc-TMX2-1-1_dup1