An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT022388.2

General info


NONCODE TRANSCRIPT IDNONHSAT022388.2
NONCODE Gene IDNONHSAG008786.2
Chromosomechr11
Start Site67291995
End Site67292622
Strand-
Exon Number1
CNCI Score-0.0573440
Length627
Assemblyhg38
Other transcript VersionsNONHSAT022388.1(old version)

Sequence


>NONHSAT022388.2
AAGTGTTTCCACTGACTGTTAAGGCAAGAGGGGGCATGTGTTGTCAGAGAAACTCTTGCTGGAAGGGTCAGGTTCCTAGGCTACCCACAAAGGATTCTGCCCCCAACACAGCCGCACCAATGACAAGCCAACATTGGTGCAAAGAGCTGCCGTGAACCACAGCCTAAATCTTTGTCTTAATGGGAAAACATATGAGGTCAGAAGTCAAGAAACTGGGGACATCTTGACCTGACCCCTCCCCACAAAGGTGGCCACAGGAGCCCAACCACCCCGGCAGTCTGAGTGAGACACGGGCTGCAGCAACCCACCTGCCCCTGAGCAGCCCCTTGTGAGTGAGCCCAGAGGCCTGAACCAGGATCTTCAAGGATCGCCCTGCCCTCATTAATGGTGGCTCTTGCTATCCGTCCCCATCCCACCCACGGTGTGCCAGGACCCGACCGACCTCTCAAAGGCCACATTACGAGTGTCCAGGTGGGTGGAGACGATAGGAGAGGTGAGGCGACTGGCCACATGCTCCTCGCTGGGCCGCATGGCGGCCAGCAGTGTTTCGGGCTCCTGCAGAGTGAGCCCCAGTGTCTCCACATGCACCACCTGCCGGTCATGGTCCACTTCCATCACCAGGGCTCC

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
1.244261.690961.020870.6029750.4236510.6519641.164920.156913
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
1.711841.642831.778070.6844540.20862800.7565264.32818
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
1.019771.064730.7231670.7178060.5447220.5246640.03958280.0954442
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
57.395174.786216.949779.193418.672
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
20.3612007.1693146.1436
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3n341054
noncodeV3Human
lncipedialnc-POLD4-1-1
NONCODEv4NONHSAT022388