An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT023109.1

General info


NONCODE TRANSCRIPT IDNONHSAT023109.1
NONCODE Gene IDNONHSAG009101.2
Chromosomechr11
Start Site75571898
End Site75572783
Strand-
Exon Number2
CNCI Score-0.0204800
Length643
Assemblyhg38
Other transcript VersionsNONHSAT023109.1(old version)

Sequence


>NONHSAT023109.1
TGTCATTGGAAAAGTTTTATTGAAAAAAAAAATGTACAAATAAGTTCTTGGATTGATAGCAACAAAGGCTCATGTTCCCCCTTCCCTCCCTATCTTTGAAGAACTAAAAAAGGAAGAAACAAAACAAAAAGTTCATCCCCACAACGCCAGACACGATGCTTCTTGACCAGAGTCTGCCCAGAAGCCCCTCCTGGGAGCTCCTTCTCAATCCGCCTCACTGCGGCCAGGTCATTCTGGGGGTGCCTGGTCCCAGGGGCTGCAGCACCTAGTTTTATAGTTGGGAGAGGTTGGGATAGAGCTGGGGAGGCAGCTGAGGTGTTTTAGTGTCAGAAGAGGGCTGGCTGACCCCCCTAGCTCAATTTGGTCTCACAGGTGAGAAGGTACCTGGCTATAAATATGAATACTGATTGAGGCAGGCTTGATCTGGGACTTTCAGGGCAGGCAGAATGACTATGGCCCTATAACTCGTCTCGCATCTTGTCACCCTTAGGCCGGACCAGGCGCCCAATGAATAGCAGGGAGCCGCTTTGGGTGTCCCGCACTAGGAAGATGAAGGGGTGGTCGGCGTAGAACAGCTTGGGGCTGCGCAGCTCCTCGCGCCCGTAGATGTCCTGGTCAAAGGGGTTGCCATCTGTGTCCAACT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT160520.1
NONHSAT023110.2
NONHSAT023111.2

Data Sources

Source NameOld Id
lncipedialnc-MAP6-1-2
PMID26117828TCONS_00005887
NONCODEv4NONHSAT023109
PMID26117828PNCT_HSA019318