An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT024298.1

General info


NONCODE TRANSCRIPT IDNONHSAT024298.1
NONCODE Gene IDNONHSAG009674.2
Chromosomechr11
Start Site115174976
End Site115175324
Strand+
Exon Number2
CNCI Score-0.0004096
Length301
Assemblyhg38
Other transcript VersionsNONHSAT024298.1(old version)

Sequence


>NONHSAT024298.1
TCAAGGTCACTGATTTTAGTAGCTATGCACTATGGCTGAGGAAAGAGGCCAAGGCTAGTGTATGAAAGGTAAAAAGATAAAAACACTCACATTTGAGTTTTGATTAAGTAACTGAAAATCCGTACATGCTGTTTTTCCACCTCTGCTCTGACCTATCGAGAACTGAGAGCGACAGCAGACCAGTGTGAGAACAATACCAGCCCTTCTTTTGTACCTCCTGCCTTTGTCAAGCCAAATCTGAAGGAATGAAAGTTTCACACAGATTCGAGTTGGAAATCCCAGCATGACAAATATCTGTAAT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA157239
noncodeV3n380727
lncipedialnc-FAM55B-1-1_dup1
NONCODEv4NONHSAT024298
PMID26117828TCONS_00005568