An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT027837.2

General info


NONCODE TRANSCRIPT IDNONHSAT027837.2
NONCODE Gene IDNONHSAG010968.2
Chromosomechr12
Start Site45874028
End Site45874328
Strand+
Exon Number1
CNCI Score-0.0524288
Length300
Assemblyhg38
Other transcript VersionsNONHSAT027837.1(old version)

Sequence


>NONHSAT027837.2
attggaatcaagcagcagtgcattcctgtactcccagctatttgggaggttgaggaaggaggattgcttgagtccaagagttctgggctgtagcacactacactgactggttgtctgcactaagttcggcatcagtatggtgacttcctgggagtagggaccaccaggttgcctaaggaagggtgaactagcccaagtcagaaatggagcaagtcaaaactccaacgctgatcagtactaggatagtgcctgtaaatagccactgcactccaacctggacaatagagcaagaccctgtct

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
0000.4050140000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
1.26320000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
1.3002500000.28758800.702078
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
07.8999706.4140211.4334
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
3.630580010.68670
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000584467
lncipedialnc-ANO6-5-1_dup1
NONCODEv4NONHSAT027837