An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT027885.1

General info


NONCODE TRANSCRIPT IDNONHSAT027885.1
NONCODE Gene IDNONHSAG010989.3
Chromosomechr12
Start Site46455090
End Site46484528
Strand+
Exon Number3
CNCI Score-0.1187840
Length232
Assemblyhg38
Other transcript VersionsNONHSAT027885.1(old version)

Sequence


>NONHSAT027885.1
tgggctcaagccatcttccctccactgcctccaagtagctggggactacaggtcatgtgagcacacagcataaaggcagctgcccacaagccaggaagagaagcatcatcagaaaccgaccatactggcttcctgatctcagactttcagcctccagaatgagatgggggtgtgaaaggaaatgaaatcttgggaccctaaactcattaagccaaagggaaaagctgggccg

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT162116.1
NONHSAT162117.1
NONHSAT162118.1
NONHSAT162119.1
NONHSAT162120.1
NONHSAT162121.1
NONHSAT162124.1
NONHSAT162126.1
NONHSAT162127.1
NONHSAT231184.1
NONHSAT231185.1
NONHSAT231186.1
NONHSAT231187.1
NONHSAT231188.1
NONHSAT231189.1
NONHSAT231190.1
NONHSAT231191.1
NONHSAT231192.1
NONHSAT231193.1
NONHSAT231194.1
NONHSAT231195.1
NONHSAT231196.1
NONHSAT231197.1
NONHSAT231198.1
NONHSAT231199.1
NONHSAT231200.1
NONHSAT027864.2
NONHSAT027865.2
NONHSAT027866.2
NONHSAT027867.2
NONHSAT027868.2
NONHSAT027869.2
NONHSAT027870.2
NONHSAT027871.2
NONHSAT027873.2
NONHSAT027876.2
NONHSAT027877.2
NONHSAT027878.2
NONHSAT027886.2
NONHSAT027892.2

Data Sources

Source NameOld Id
lncipedialnc-ARID2-3-9_dup1
PMID26117828PNCT_HSA161174
PMID26117828TCONS_00008540
noncodeV3n373010
noncodeV3Human
NONCODEv4NONHSAT027885