An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT027885.2

General info


NONCODE TRANSCRIPT IDNONHSAT027885.2
NONCODE Gene IDNONHSAG010989.3
Chromosomechr12
Start Site46455090
End Site46484528
Strand+
Exon Number3
CNCI Score-0.1187840
Length232
Assemblyhg38
Other transcript VersionsNONHSAT027885.1(old version)

Sequence


>NONHSAT027885.2
tgggctcaagccatcttccctccactgcctccaagtagctggggactacaggtcatgtgagcacacagcataaaggcagctgcccacaagccaggaagagaagcatcatcagaaaccgaccatactggcttcctgatctcagactttcagcctccagaatgagatgggggtgtgaaaggaaatgaaatcttgggaccctaaactcattaagccaaagggaaaagctgggccg

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT162116.1
NONHSAT162117.1
NONHSAT162118.1
NONHSAT162119.1
NONHSAT162120.1
NONHSAT162121.1
NONHSAT162124.1
NONHSAT162126.1
NONHSAT162127.1
NONHSAT231184.1
NONHSAT231185.1
NONHSAT231186.1
NONHSAT231187.1
NONHSAT231188.1
NONHSAT231189.1
NONHSAT231190.1
NONHSAT231191.1
NONHSAT231192.1
NONHSAT231193.1
NONHSAT231194.1
NONHSAT231195.1
NONHSAT231196.1
NONHSAT231197.1
NONHSAT231198.1
NONHSAT231199.1
NONHSAT231200.1
NONHSAT027864.2
NONHSAT027865.2
NONHSAT027866.2
NONHSAT027867.2
NONHSAT027868.2
NONHSAT027869.2
NONHSAT027870.2
NONHSAT027871.2
NONHSAT027873.2
NONHSAT027876.2
NONHSAT027877.2
NONHSAT027878.2
NONHSAT027886.2
NONHSAT027892.2
NONHSAT259190.1
NONHSAT259191.1

Data Sources


Source NameOld Id
lncipedialnc-ARID2-3-9_dup1
PMID26117828PNCT_HSA161174
PMID26117828TCONS_00008540
noncodeV3n373010
noncodeV3Human
NONCODEv4NONHSAT027885