An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT027886.1

General info


NONCODE TRANSCRIPT IDNONHSAT027886.1
NONCODE Gene IDNONHSAG010989.3
Chromosomechr12
Start Site46455100
End Site46484880
Strand+
Exon Number2
CNCI Score-0.0004096
Length464
Assemblyhg38
Other transcript VersionsNONHSAT027886.1(old version)

Sequence


>NONHSAT027886.1
ccatcttccctccactgcctccaagtagctggggactacagagatgggggtgtgaaaggaaatgaaatcttgggaccctaaactcattaagccaaagggaaaagctgggccgagaactggatgatgcaacctgcttccacctttttgcttcctaaataagatggctacaagatgaaaagctatacatctctgccatattttgcccacaaggaaattcctagtgagcttcaagatcttttaaggtgtttctgttaaaatttcacaatttcgccattgcaatgtaaatttatagcttatccttacaggtgcagtcatctccctgcccaccagacacaaaggcatatctgattgttctcctgccccattttgtctatgttatcttatgtaaaatacagataccctgcatttttcctctgccccatttgtctatatcaccttatataaaaaaatgcagagtcactgag

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT162116.1
NONHSAT162117.1
NONHSAT162118.1
NONHSAT162119.1
NONHSAT162120.1
NONHSAT162121.1
NONHSAT162124.1
NONHSAT162126.1
NONHSAT162127.1
NONHSAT231184.1
NONHSAT231185.1
NONHSAT231186.1
NONHSAT231187.1
NONHSAT231188.1
NONHSAT231189.1
NONHSAT231190.1
NONHSAT231191.1
NONHSAT231192.1
NONHSAT231193.1
NONHSAT231194.1
NONHSAT231195.1
NONHSAT231196.1
NONHSAT231197.1
NONHSAT231198.1
NONHSAT231199.1
NONHSAT231200.1
NONHSAT027864.2
NONHSAT027865.2
NONHSAT027866.2
NONHSAT027867.2
NONHSAT027868.2
NONHSAT027869.2
NONHSAT027870.2
NONHSAT027871.2
NONHSAT027873.2
NONHSAT027876.2
NONHSAT027877.2
NONHSAT027878.2
NONHSAT027885.2
NONHSAT027892.2

Data Sources

Source NameOld Id
NONCODEv4NONHSAT027886
noncodeV3n373011
PMID26117828PNCT_HSA161175
lncipedialnc-ARID2-3-10_dup1
noncodeV3Human
PMID26117828TCONS_00008541