An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT027886.1

General info


NONCODE TRANSCRIPT IDNONHSAT027886.1
NONCODE Gene IDNONHSAG010988.1
Chromosomechr12
Start Site46848883
End Site46878663
Strand+
Exon Number2
CNCI Score-0.8632011
Length464
Assemblyhg19
Other transcript VersionsNONHSAT027886.2

Sequence


>NONHSAT027886.1
ccatcttccctccactgcctccaagtagctggggactacagagatgggggtgtgaaaggaaatgaaatcttgggaccctaaactcattaagccaaagggaaaagctgggccgagaactggatgatgcaacctgcttccacctttttgcttcctaaataagatggctacaagatgaaaagctatacatctctgccatattttgcccacaaggaaattcctagtgagcttcaagatcttttaaggtgtttctgttaaaatttcacaatttcgccattgcaatgtaaatttatagcttatccttacaggtgcagtcatctccctgcccaccagacacaaaggcatatctgattgttctcctgccccattttgtctatgttatcttatgtaaaatacagataccctgcatttttcctctgccccatttgtctatatcaccttatataaaaaaatgcagagtcactgag

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT027864.1
NONHSAT027865.1
NONHSAT027866.1
NONHSAT027867.1
NONHSAT027868.1
NONHSAT027869.1
NONHSAT027870.1
NONHSAT027871.1
NONHSAT027872.1
NONHSAT027873.1
NONHSAT027876.1
NONHSAT027877.1
NONHSAT027884.1
NONHSAT027885.1
NONHSAT162116.1
NONHSAT162117.1
NONHSAT162118.1
NONHSAT162119.1
NONHSAT162120.1
NONHSAT162121.1
NONHSAT162124.1
NONHSAT162126.1
NONHSAT162127.1
NONHSAT027892.2

Data Sources


Source NameOld Id
NONCODEv4NONHSAT027886
noncodeV3n373011
PMID26117828PNCT_HSA161175
lncipedialnc-ARID2-3-10_dup1
noncodeV3Human
PMID26117828TCONS_00008541