An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT027886.2

General info


NONCODE TRANSCRIPT IDNONHSAT027886.2
NONCODE Gene IDNONHSAG010989.3
Chromosomechr12
Start Site46455100
End Site46484880
Strand+
Exon Number2
CNCI Score-0.0004096
Length464
Assemblyhg38
Other transcript VersionsNONHSAT027886.1(old version)

Sequence


>NONHSAT027886.2
ccatcttccctccactgcctccaagtagctggggactacagagatgggggtgtgaaaggaaatgaaatcttgggaccctaaactcattaagccaaagggaaaagctgggccgagaactggatgatgcaacctgcttccacctttttgcttcctaaataagatggctacaagatgaaaagctatacatctctgccatattttgcccacaaggaaattcctagtgagcttcaagatcttttaaggtgtttctgttaaaatttcacaatttcgccattgcaatgtaaatttatagcttatccttacaggtgcagtcatctccctgcccaccagacacaaaggcatatctgattgttctcctgccccattttgtctatgttatcttatgtaaaatacagataccctgcatttttcctctgccccatttgtctatatcaccttatataaaaaaatgcagagtcactgag

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000000
foreskinheartheart_RHLF_1HLF_2kidney
000000
liverliver_RlunglymphNodeovaryplacenta_R
000000
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT162116.1
NONHSAT162117.1
NONHSAT162118.1
NONHSAT162119.1
NONHSAT162120.1
NONHSAT162121.1
NONHSAT162124.1
NONHSAT162126.1
NONHSAT162127.1
NONHSAT231184.1
NONHSAT231185.1
NONHSAT231186.1
NONHSAT231187.1
NONHSAT231188.1
NONHSAT231189.1
NONHSAT231190.1
NONHSAT231191.1
NONHSAT231192.1
NONHSAT231193.1
NONHSAT231194.1
NONHSAT231195.1
NONHSAT231196.1
NONHSAT231197.1
NONHSAT231198.1
NONHSAT231199.1
NONHSAT231200.1
NONHSAT027864.2
NONHSAT027865.2
NONHSAT027866.2
NONHSAT027867.2
NONHSAT027868.2
NONHSAT027869.2
NONHSAT027870.2
NONHSAT027871.2
NONHSAT027873.2
NONHSAT027876.2
NONHSAT027877.2
NONHSAT027878.2
NONHSAT027885.2
NONHSAT027892.2
NONHSAT259190.1
NONHSAT259191.1

Data Sources


Source NameOld Id
NONCODEv4NONHSAT027886
noncodeV3n373011
PMID26117828PNCT_HSA161175
lncipedialnc-ARID2-3-10_dup1
noncodeV3Human
PMID26117828TCONS_00008541