An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT027957.1

General info


NONCODE TRANSCRIPT IDNONHSAT027957.1
NONCODE Gene IDNONHSAG011027.1
Chromosomechr12
Start Site48258835
End Site48272827
Strand-
Exon Number2
CNCI Score-0.0779360
Length201
Assemblyhg19
Other transcript VersionsNONHSAT027957.2

Sequence


>NONHSAT027957.1
TGTGGGGTGTGTGGAGACCGAGCCACTGGCTTTCACTTCAATGCTATGACCTGTGAAGGCTGCAAAGGCTTCTTCAGCGAAGCATGAAGCGGAAGGCACTATTCACCTGCCCCTTCAACGGGGACTGCCGCATCACCAAGGACAACCGACGCCACTGCCAGGCCTGCCGGCTCAAACGCTGTGTGGACATCGGCATGATGA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT027957
lncipedialnc-HDAC7-2-1
noncodeV3n334134
PMID26117828PNCT_HSA161258