An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028511.1

General info


NONCODE TRANSCRIPT IDNONHSAT028511.1
NONCODE Gene IDNONHSAG011264.3
Chromosomechr12
Start Site53962625
End Site53966193
Strand-
Exon Number3
CNCI Score-0.0348160
Length685
Assemblyhg38
Other transcript VersionsNONHSAT028511.1(old version)

Sequence


>NONHSAT028511.1
CGGGGAGCGGAGCCAGAGAGAGAAAAAGAGAGAAAAGTTTCCCGGAGTCTTCATTAGTTGATTTCCCTGTCCGCCGCTTTCCCCGGCCGGCTCACCCCCGGTAAAGGAAGGAGGGGCGTCTTTATTTTTTTAAGGCCCCAAAGAGTCTGATGTTTACAAGACCAGAAATGCCACGGCCGCGTCCTGGCAGAGAAAAGGCTGAAATGGAGGACCGGCGCCTTCCTTATAAGCTCGTTGGGGCCTAAGCCAGTACCGACCTGGTAGAAAAAGCAACCACGAAGCTAGAGAGAGAGCCAGAGGAGGGAAGAGAGCGCCAGACGAAGGTGAAAGCGAACCACGCAGAGAAATGCAGGCAAGGGAGCAAGGCGGCAGTTCCCGGAACAAACGTGGCAGAGGGCAAGACGGGCACTCACAGACAGAGGAGTGATTATGCAGTGGGACCCTGCTGCAAACGGGACTTTGCACTCTAAATATAGACCCCAGCTTGGGACAAAAGTTGCAGTAGAAAAATAGACATAGGAGAACACTTAAATAAGTGATGCATGTAGACACAGAAGGGGTATTTAAAAGACAGAAATAATAGAAGTACAGAAGAACAGAAAAAAAATCAGCAGATGGAGATTACCATTCCCAATGCCTGAACTTCCTCCTGCTATTAAGATTGCTAGAGAATTGTGTCTTAAAC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT163579.1
NONHSAT232115.1
NONHSAT028507.2
NONHSAT028509.2
NONHSAT028510.2
NONHSAT028512.2
NONHSAT028513.2
NONHSAT028514.2

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA024241
NONCODEv4NONHSAT028511
lncipedialnc-SMUG1-7-10_dup1
PMID26117828TCONS_00008338