An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028517.1

General info


NONCODE TRANSCRIPT IDNONHSAT028517.1
NONCODE Gene IDNONHSAG011265.3
Chromosomechr12
Start Site53983449
End Site53984838
Strand-
Exon Number2
CNCI Score-0.0696320
Length544
Assemblyhg38
Other transcript VersionsNONHSAT028517.1(old version)

Sequence


>NONHSAT028517.1
AGTAACCAGCCTGTAACTCCTGGGGAGAAGGGGGCGGAGAGGGGGGAAATGCGGGAGAGAGGGAGAGAGCGAGGCAACCCGGGGCTCAAAACAGTCAAATTCAAATTAAAAGGTCGAGACACGAATCAGGAAACGGAATCTGGAGAACAACTTGTCTTTCCTGTCGCCCCACATTTTTCCTTGGACAGAGCCTAGGGTTCAGACTTTCCGAAGGGCTGGAGTTTGGCGGGGAAAGGACTGGAGCCCAGCGCCCTGGAGTGGAGGAGTGAGGAGGCTAGACCGTTTCTAAGGAGGCCCAAGCCCGCTGCGGCTAGAAGACCGCAGAAAGAAATCCGCCGAATTTCCCCATCCAGGGGTGGAGAGAGAAGACGCAGGGGTTCCTGAACCTCCGGAAAACTGGAAGGAAATGTGGAGTGTATGATTTGCTTGCAGGACCGGCCAGGGGAGATTTGAAATGGTTTTGTGTTTTCATATGCAGGGTCACCGTGGCCTCAGCATGGGGGTTATCCAGGGCAAGGTTAGGCTGTTTAGGCCCCAGACTTGG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT163580.1
NONHSAT232116.1
NONHSAT232117.1
NONHSAT028516.2
NONHSAT028519.2

Data Sources

Source NameOld Id
NONCODEv4NONHSAT028517
lncipedialnc-SMUG1-6-2_dup1
PMID26117828TCONS_00007757
PMID26117828PNCT_HSA024243
ensemblENST00000509870
gencodeENST00000509870.1