An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028517.1

General info


NONCODE TRANSCRIPT IDNONHSAT028517.1
NONCODE Gene IDNONHSAG011265.1
Chromosomechr12
Start Site54377233
End Site54378622
Strand-
Exon Number2
CNCI Score-0.1727769
Length544
Assemblyhg19
Other transcript VersionsNONHSAT028517.2

Sequence


>NONHSAT028517.1
AGTAACCAGCCTGTAACTCCTGGGGAGAAGGGGGCGGAGAGGGGGGAAATGCGGGAGAGAGGGAGAGAGCGAGGCAACCCGGGGCTCAAAACAGTCAAATTCAAATTAAAAGGTCGAGACACGAATCAGGAAACGGAATCTGGAGAACAACTTGTCTTTCCTGTCGCCCCACATTTTTCCTTGGACAGAGCCTAGGGTTCAGACTTTCCGAAGGGCTGGAGTTTGGCGGGGAAAGGACTGGAGCCCAGCGCCCTGGAGTGGAGGAGTGAGGAGGCTAGACCGTTTCTAAGGAGGCCCAAGCCCGCTGCGGCTAGAAGACCGCAGAAAGAAATCCGCCGAATTTCCCCATCCAGGGGTGGAGAGAGAAGACGCAGGGGTTCCTGAACCTCCGGAAAACTGGAAGGAAATGTGGAGTGTATGATTTGCTTGCAGGACCGGCCAGGGGAGATTTGAAATGGTTTTGTGTTTTCATATGCAGGGTCACCGTGGCCTCAGCATGGGGGTTATCCAGGGCAAGGTTAGGCTGTTTAGGCCCCAGACTTGG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT028516.1
NONHSAT028518.1
NONHSAT028519.1
NONHSAT163580.1

Data Sources


Source NameOld Id
NONCODEv4NONHSAT028517
lncipedialnc-SMUG1-6-2_dup1
PMID26117828TCONS_00007757
PMID26117828PNCT_HSA024243
ensemblENST00000509870
gencodeENST00000509870.1