An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028519.1

General info


NONCODE TRANSCRIPT IDNONHSAT028519.1
NONCODE Gene IDNONHSAG011265.3
Chromosomechr12
Start Site53983950
End Site53985586
Strand-
Exon Number3
CNCI Score-0.0081920
Length435
Assemblyhg38
Other transcript VersionsNONHSAT028519.1(old version)

Sequence


>NONHSAT028519.1
ATTCTCCTCCTTGACACTAGGTGGGTAGGAGCAGGAGGACAGCGGCCTGCCAACAGGTTGTTCCAGGCGATAGGCGGCTTTGGGGTCGCCCCAGGAGTCCAGCTGCGAGAGACCAATGGGATTTGAAAATGGCCTTGATGATTCAGACGGCCGTGACGTCAGCGGGGTCAAGTTGTCGGCAGGCGGAGCGCGCAGAGTGGAGTAACAGCGCCATCTAGCAGCTGCCTCGGGGGAATATTCCGGGAAAGAAAGAGGGAACCTGCGGAGCCTCGGTCAGTTTGGAGGAGTCACGTATCACACGGGAAACCAGCACACAAGACGCAACAAAACCCGACCCAGAGAAGCGTCCTTTACAGAGCGCACGGGCTGGGAGCATGTTTGAAAGAAGACAGACCAGTCTATTTTTGTGGTTGTTTTTAAATAAAAGGAAGAAAT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT163580.1
NONHSAT232116.1
NONHSAT232117.1
NONHSAT028516.2
NONHSAT028517.2

Data Sources

Source NameOld Id
PMID26117828TCONS_00007759
PMID26117828PNCT_HSA024245
refseqNR_047506
NAMEHOXC-AS3
NONCODEv4NONHSAT028519
gencodeENST00000514702.1
ensemblENST00000514702
lncipedialnc-SMUG1-6-1_dup1