An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028529.1

General info


NONCODE TRANSCRIPT IDNONHSAT028529.1
NONCODE Gene IDNONHSAG011267.2
Chromosomechr12
Start Site53995207
End Site53996785
Strand-
Exon Number3
CNCI Score-0.0626688
Length504
Assemblyhg38
Other transcript VersionsNONHSAT028529.1(old version)

Sequence


>NONHSAT028529.1
AGGTTCCGCAGGTCCACAACTGCATGTGGCCTGTAGCCCCCATTCTCCACATTTGGAGGGGTGTGGGTGGCAGACCAGGGCTTTGAAGCGGACCTGCAGATTTCCCTCAAATCCAGCTAAGGCCTGCGCTGGAAGCAGAAACTGAGTTCTCTTGGCCTGCCGCGAGGAAACCCGCGTCCTGCCCCCACCCAAGGAAATTTGCAGTGACTTTGGAGCCCAGACTGAGGAAGCGGAGGTGGCGAAAGGAGAGACAATACGAGCCCGAAGTACAATTAAGGGGCCAGAGCCGCTCGTCTCTCCCCCGCCCTCCCTGCCCGACTGCGAGCTGTCTGGCCTCAAACCTCAGGGCGACACGCGAACCTGGAGCCGGAAACTCAGCCCGTGGCAGAGGGAGTCAGAGGACTCTGCATCCAGAAAACAGAAGCAAAGCGCCCTTCCAACTTGGGGACGCCTTAACCAGCCCCTCTCAGTTGCAGATAACCCAATGAATGAAAGTGCAAATTC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT163581.1
NONHSAT028527.2
NONHSAT028528.2

Data Sources

Source NameOld Id
NONCODEv4NONHSAT028529
PMID26117828TCONS_00007760
refseqNR_047505
NAMEHOXC-AS2
PMID26117828PNCT_HSA024251
lncipedialnc-SMUG1-5-1_dup1
ensemblENST00000513533
gencodeENST00000513533.1