An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028530.1

General info


NONCODE TRANSCRIPT IDNONHSAT028530.1
NONCODE Gene IDNONHSAG011268.2
Chromosomechr12
Start Site53999021
End Site54000010
Strand-
Exon Number2
CNCI Score-0.0081920
Length548
Assemblyhg38
Other transcript VersionsNONHSAT028530.1(old version)

Sequence


>NONHSAT028530.1
GGCTTTTTTTTCCTTGCCTTCTTTTCCCCCTCTCCCACCCCCTTCTCTCTGCTGCTCCCCGCGACCTGCGATTTCCTGGGGGTCCGGAACTCTGGACCCAAGGCACCGGTCACCCCCTCAGGACGGCTCCTAGCTCATCTGAGAAGCCCCTGTGCCCATGTCCACCCATAAGCAGATGGCCTCCCCCCAACCATGAGGATTTTTTAATGGGGTGAAAATGCCAGTCCCCGAAGCCAGGGTTCTCGGACCCCCAGGGCCGAGCTGGGCGCGGGAGCCCCGCAGGGGCGGGGAGGCCGACCGAGCTTGAAGAAGTGTAGGAGAGATCTACACAACTTAAGTGGGGCGTCCCCATCCCATCTTCCTGCGCACCCTCCTTTGCCCCCAACTCCATCTCTGCGACACTTCCCCACCCCCACTCCCCCCAAAAAGTCGCTCCCGGGCTCTGTCTGCAGAGAGCCAGGGTGAGAGCGGGCAAGGCAAAAGAGCGACCTCGGTCGTGGGCAAGTAGCTTGTTTTTACGTCCCTCAATAAAATTTTTATGAGGATCA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT163582.1
NONHSAT028531.2

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA024252
gencodeENST00000505700.1
lncipedialnc-SMUG1-4-1_dup1
ensemblENST00000505700
NONCODEv4NONHSAT028530
PMID26117828TCONS_00007762
refseqNR_047504
NAMEHOXC-AS1