An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028530.1

General info


NONCODE TRANSCRIPT IDNONHSAT028530.1
NONCODE Gene IDNONHSAG011268.1
Chromosomechr12
Start Site54392805
End Site54393794
Strand-
Exon Number2
CNCI Score-0.0251682
Length548
Assemblyhg19
Other transcript VersionsNONHSAT028530.2

Sequence


>NONHSAT028530.1
GGCTTTTTTTTCCTTGCCTTCTTTTCCCCCTCTCCCACCCCCTTCTCTCTGCTGCTCCCCGCGACCTGCGATTTCCTGGGGGTCCGGAACTCTGGACCCAAGGCACCGGTCACCCCCTCAGGACGGCTCCTAGCTCATCTGAGAAGCCCCTGTGCCCATGTCCACCCATAAGCAGATGGCCTCCCCCCAACCATGAGGATTTTTTAATGGGGTGAAAATGCCAGTCCCCGAAGCCAGGGTTCTCGGACCCCCAGGGCCGAGCTGGGCGCGGGAGCCCCGCAGGGGCGGGGAGGCCGACCGAGCTTGAAGAAGTGTAGGAGAGATCTACACAACTTAAGTGGGGCGTCCCCATCCCATCTTCCTGCGCACCCTCCTTTGCCCCCAACTCCATCTCTGCGACACTTCCCCACCCCCACTCCCCCCAAAAAGTCGCTCCCGGGCTCTGTCTGCAGAGAGCCAGGGTGAGAGCGGGCAAGGCAAAAGAGCGACCTCGGTCGTGGGCAAGTAGCTTGTTTTTACGTCCCTCAATAAAATTTTTATGAGGATCA

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT028531.1

Data Sources


Source NameOld Id
PMID26117828PNCT_HSA024252
gencodeENST00000505700.1
lncipedialnc-SMUG1-4-1_dup1
ensemblENST00000505700
NONCODEv4NONHSAT028530
PMID26117828TCONS_00007762
refseqNR_047504
NAMEHOXC-AS1