An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028531.1

General info


NONCODE TRANSCRIPT IDNONHSAT028531.1
NONCODE Gene IDNONHSAG011268.2
Chromosomechr12
Start Site53999021
End Site53999650
Strand-
Exon Number2
CNCI Score-0.0737280
Length320
Assemblyhg38
Other transcript VersionsNONHSAT028531.1(old version)

Sequence


>NONHSAT028531.1
AGTCTCTGCGCGAGCCGAGATCAGCGATTGTCAGTTCGGAACGTGGCTTTTAAAAATGCGTTTTTAAATAGTGTCTTGAAGAAGTGTAGGAGAGATCTACACAACTTAAGTGGGGCGTCCCCATCCCATCTTCCTGCGCACCCTCCTTTGCCCCCAACTCCATCTCTGCGACACTTCCCCACCCCCACTCCCCCCAAAAAGTCGCTCCCGGGCTCTGTCTGCAGAGAGCCAGGGTGAGAGCGGGCAAGGCAAAAGAGCGACCTCGGTCGTGGGCAAGTAGCTTGTTTTTACGTCCCTCAATAAAATTTTTATGAGGATCA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT163582.1
NONHSAT028530.2

Data Sources

Source NameOld Id
lncipedialnc-SMUG1-4-2_dup1
PMID26117828TCONS_00007761
PMID26117828PNCT_HSA024253
NONCODEv4NONHSAT028531
ensemblENST00000512427
gencodeENST00000512427.4