An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028541.1

General info


NONCODE TRANSCRIPT IDNONHSAT028541.1
NONCODE Gene IDNONHSAG011270.2
Chromosomechr12
Start Site54019909
End Site54022589
Strand+
Exon Number1
CNCI Score-0.0204800
Length2680
Assemblyhg38
Other transcript VersionsNONHSAT028541.1(old version)

Sequence


>NONHSAT028541.1
CAAGACAGAGGCAAGCAGAGAAGGCATAGCAGCAGCGACCGGCGCTCTGTTTTCATTTTCCACTCTGGCCAGGGGATAAACTGGACCCCAGTGGACTCCAACACCAACTCTCTGCTTCCCAGTTACTTTCGATTTTCTTTCCCTTCTCCTTCTTTCTCTCCCTCTCTGGCATTCAAACAGAAGCACAAGAGGACCCACCAGTGGCAACTCTAAGCCTCCTTGCAGGCCACATTCCCTGCTGACGTGGTCCTTCCTGCAGGAGAGCCCTTCTGTGATTATCTAATAATAGCCAGGGTGGCTGAGAATAGAATCTGGCTCAAGGACTCTGCACACCCGGGGCAGAGACACTGAATCTGTGGGTCAGGGCCTGGCAACATTCCTTGGAGCCTCCCCCTCTGAGCCCACTCTTTGGGCACCCTTAGGCTTGCCTGCCCCCCTTATAAGGGGCTTTGTCAGCCCTGCCATCCGCTGTATTTCATGTGCTGGTTCCTAGCTAAGGAGAATTGGGCAGAGCAAACCCTTTCTCACCCTGGTCTGACAGTTGTGATCCCGACAGAATGCGACCTTGTTTGGAGAAGGCGACCTTGTTGGGTTGGCTGTGTTCTGAAACCAGGCTTGGGAGTGTTATATATTTATTATATACAGGCTTAAATATACAGACTCAGGCTTATGCATGAATATATACAGACTCATATTTCCTTGGTGGTTAATTGTATATTACCATGCCTATATTCGCTCAAACACCATTTTATGTTCATGCAAAATTTTGTTAGTCCTCACTAGATGAGAGTGGGCTCATGGAGGCACCGGGTGCACTGAGCAGGCCCTCTGTGCATGCTCTGCTGGAAATATGTGCTCACTGGAATCGGAGTATGCGGGTTCCAGTAACCAATGGATGCCATAAAGGCTTTCTCAGACCTTATTGCTTTTGTTGCCCAAGCAGCTGGACTGGGGAAATACTAAATCCCTTCTGCTTTCTCTCCACACCTCCTGGCAAACTCTCCCAACTTAGAAATTATTTTACAAGGGAGACCAGTTGTCTTGAAATTGAGTTCTGCGGGATTCTTTTCACGGGCATGGTGGGGCTGCAAGCAGTTCGGAGTAGTCAGGGCCCTGGCGCTGGAAGCCTCACTGGAGCGATGAAGGGATCAGAGTGGTTAATAAGGTGGCCTCTGGACAGTGATCTGGGGCAGCTGCTGGCCAGGGTGCTTGGAGAAGCTTGTGGAAAAGGCAAGCCAAAAGGGGTAGGGATGCAGTGAATATCTGTTTCTCCCCCTGCTTGCCCCAGCCGGCCGCTCACCCCGCCCCAGCCCGATTTGCCTGCATCCGTGGCGGCAGATTGGGAGTTCTCTAAGGTCCCCCAAATACCCAGATCTGGTTACTGGATGAACTGCGTTTTAATCCTCGTCGCTATCTGAGCCAGGACAAGACCTGGTCAGGGAGACGGCTGGTCCGGGCAGCACGGGAGAGGACGCTGGACCCGCTGCCTGTGGCCTGGAGCACTGAGTATGGGCTACCAAGGCTGAGAATTGATGGGCCTCCTTTCCCAGCCTTTTTCCCTTCCAGAGACACAAAAAGACAGAGCAGAGGGGAAATATCAATGTCAGTGGAAAACCCCATAAAAGAAAGCAGGGACCAGAGCGGGGCTGGAGGGGTTTTCCGCTACTCTCTCTAGGTGATCGGGTTCCTCCCAAGACTCTTGTCCAGACAGGCTGCACCAAGAGGTGTGCAGCTTTCTTCCACCTTCCTCCCGCCCTTCAAGGAGGGCAGCCTTAGGCTTTCTGGGCCTTGGTCACCCCAGGCACTGGGGTGACATTACTCCAGGATTGTGCCCCTCGCCCAGCCCACGGCCTCTGCCACGGCGCCGCAGCCGCTCCTGTTTATTGTGTCTGTGAGTTGTTTACTTGTTTTGTCTGCTGCCACCCTGCGTCAGAAACCCGCCAAACCAGCGAACTCGCCCAGGAGAACAAAGTGCTGTGCTATCCCCGGACTCCCTCCCCTTTCCAGCAACCCCCTCCTGCCCTCACAAGCTCCTGCATTCTCCCTTTCGGAGGGGAGGAAGCAGAAATAGTCTTAAAACAGGGCAGCTGTTTATAGGGTCAGGGGAATTATGGGGACACCATAAACCTCTGGGTGTCCCTGTGGTGGACAGACTTCTGAGCAGCCCTTCCCTTGCCTAGGCTTTTCTTCCTTCCCCTGGTGACCACTTGGTTAAGGGGGCCACACTCATTGAGAAAGTTGAGCCCACCCCCATCAACCCAGTCCCCCACTACCCCACTCCTTTCTGCAGGAGTTTCCCTGAGACACAGGTTGTTGGGTTTTAAATCAGGGTAATGTTGGTGGATTCATAAAGCTAGATATAGCATGTCATTCTTCTCCCACACTCCCTCTCCTCAGCCCCCCAAAATTGCAGTGAATTTAAGCAAATCCTACAAAATTAAATTGCCCCTTTGCTAAAGATCCTATATGTCTCCAATCCTGCCAGGTGTAGAGTCAGATAGTTGGCTTTTGGCCTTTAATTTTGCTGCTAGCTATTAAATTTAAAAGAGTATCATTGAAGTAAGTAATATTCTCATTTCTGAAATTAATTTTCCCCTCCCAGTCTCTCTCTCTCTCTTTTTGCCAGCACAGATTAAATGGTTCTTTCAGATCTGCAAACAATAAAGGATAAAATTATTTA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT028541
gencodeENST00000562848.1
PMID26117828TCONS_00007340
ensemblENST00000562848
lncipedialnc-HOXC8-1-1_dup1