An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT028541.1

General info


NONCODE TRANSCRIPT IDNONHSAT028541.1
NONCODE Gene IDNONHSAG011270.1
Chromosomechr12
Start Site54413693
End Site54416373
Strand+
Exon Number1
CNCI Score-0.0508017
Length2680
Assemblyhg19
Other transcript VersionsNONHSAT028541.2

Sequence


>NONHSAT028541.1
CAAGACAGAGGCAAGCAGAGAAGGCATAGCAGCAGCGACCGGCGCTCTGTTTTCATTTTCCACTCTGGCCAGGGGATAAACTGGACCCCAGTGGACTCCAACACCAACTCTCTGCTTCCCAGTTACTTTCGATTTTCTTTCCCTTCTCCTTCTTTCTCTCCCTCTCTGGCATTCAAACAGAAGCACAAGAGGACCCACCAGTGGCAACTCTAAGCCTCCTTGCAGGCCACATTCCCTGCTGACGTGGTCCTTCCTGCAGGAGAGCCCTTCTGTGATTATCTAATAATAGCCAGGGTGGCTGAGAATAGAATCTGGCTCAAGGACTCTGCACACCCGGGGCAGAGACACTGAATCTGTGGGTCAGGGCCTGGCAACATTCCTTGGAGCCTCCCCCTCTGAGCCCACTCTTTGGGCACCCTTAGGCTTGCCTGCCCCCCTTATAAGGGGCTTTGTCAGCCCTGCCATCCGCTGTATTTCATGTGCTGGTTCCTAGCTAAGGAGAATTGGGCAGAGCAAACCCTTTCTCACCCTGGTCTGACAGTTGTGATCCCGACAGAATGCGACCTTGTTTGGAGAAGGCGACCTTGTTGGGTTGGCTGTGTTCTGAAACCAGGCTTGGGAGTGTTATATATTTATTATATACAGGCTTAAATATACAGACTCAGGCTTATGCATGAATATATACAGACTCATATTTCCTTGGTGGTTAATTGTATATTACCATGCCTATATTCGCTCAAACACCATTTTATGTTCATGCAAAATTTTGTTAGTCCTCACTAGATGAGAGTGGGCTCATGGAGGCACCGGGTGCACTGAGCAGGCCCTCTGTGCATGCTCTGCTGGAAATATGTGCTCACTGGAATCGGAGTATGCGGGTTCCAGTAACCAATGGATGCCATAAAGGCTTTCTCAGACCTTATTGCTTTTGTTGCCCAAGCAGCTGGACTGGGGAAATACTAAATCCCTTCTGCTTTCTCTCCACACCTCCTGGCAAACTCTCCCAACTTAGAAATTATTTTACAAGGGAGACCAGTTGTCTTGAAATTGAGTTCTGCGGGATTCTTTTCACGGGCATGGTGGGGCTGCAAGCAGTTCGGAGTAGTCAGGGCCCTGGCGCTGGAAGCCTCACTGGAGCGATGAAGGGATCAGAGTGGTTAATAAGGTGGCCTCTGGACAGTGATCTGGGGCAGCTGCTGGCCAGGGTGCTTGGAGAAGCTTGTGGAAAAGGCAAGCCAAAAGGGGTAGGGATGCAGTGAATATCTGTTTCTCCCCCTGCTTGCCCCAGCCGGCCGCTCACCCCGCCCCAGCCCGATTTGCCTGCATCCGTGGCGGCAGATTGGGAGTTCTCTAAGGTCCCCCAAATACCCAGATCTGGTTACTGGATGAACTGCGTTTTAATCCTCGTCGCTATCTGAGCCAGGACAAGACCTGGTCAGGGAGACGGCTGGTCCGGGCAGCACGGGAGAGGACGCTGGACCCGCTGCCTGTGGCCTGGAGCACTGAGTATGGGCTACCAAGGCTGAGAATTGATGGGCCTCCTTTCCCAGCCTTTTTCCCTTCCAGAGACACAAAAAGACAGAGCAGAGGGGAAATATCAATGTCAGTGGAAAACCCCATAAAAGAAAGCAGGGACCAGAGCGGGGCTGGAGGGGTTTTCCGCTACTCTCTCTAGGTGATCGGGTTCCTCCCAAGACTCTTGTCCAGACAGGCTGCACCAAGAGGTGTGCAGCTTTCTTCCACCTTCCTCCCGCCCTTCAAGGAGGGCAGCCTTAGGCTTTCTGGGCCTTGGTCACCCCAGGCACTGGGGTGACATTACTCCAGGATTGTGCCCCTCGCCCAGCCCACGGCCTCTGCCACGGCGCCGCAGCCGCTCCTGTTTATTGTGTCTGTGAGTTGTTTACTTGTTTTGTCTGCTGCCACCCTGCGTCAGAAACCCGCCAAACCAGCGAACTCGCCCAGGAGAACAAAGTGCTGTGCTATCCCCGGACTCCCTCCCCTTTCCAGCAACCCCCTCCTGCCCTCACAAGCTCCTGCATTCTCCCTTTCGGAGGGGAGGAAGCAGAAATAGTCTTAAAACAGGGCAGCTGTTTATAGGGTCAGGGGAATTATGGGGACACCATAAACCTCTGGGTGTCCCTGTGGTGGACAGACTTCTGAGCAGCCCTTCCCTTGCCTAGGCTTTTCTTCCTTCCCCTGGTGACCACTTGGTTAAGGGGGCCACACTCATTGAGAAAGTTGAGCCCACCCCCATCAACCCAGTCCCCCACTACCCCACTCCTTTCTGCAGGAGTTTCCCTGAGACACAGGTTGTTGGGTTTTAAATCAGGGTAATGTTGGTGGATTCATAAAGCTAGATATAGCATGTCATTCTTCTCCCACACTCCCTCTCCTCAGCCCCCCAAAATTGCAGTGAATTTAAGCAAATCCTACAAAATTAAATTGCCCCTTTGCTAAAGATCCTATATGTCTCCAATCCTGCCAGGTGTAGAGTCAGATAGTTGGCTTTTGGCCTTTAATTTTGCTGCTAGCTATTAAATTTAAAAGAGTATCATTGAAGTAAGTAATATTCTCATTTCTGAAATTAATTTTCCCCTCCCAGTCTCTCTCTCTCTCTTTTTGCCAGCACAGATTAAATGGTTCTTTCAGATCTGCAAACAATAAAGGATAAAATTATTTA

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
NONCODEv4NONHSAT028541
gencodeENST00000562848.1
PMID26117828TCONS_00007340
ensemblENST00000562848
lncipedialnc-HOXC8-1-1_dup1