An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT029116.2

General info


NONCODE TRANSCRIPT IDNONHSAT029116.2
NONCODE Gene IDNONHSAG011515.2
Chromosomechr12
Start Site63684747
End Site63724935
Strand-
Exon Number4
CNCI Score-0.0036864
Length679
Assemblyhg38
Other transcript VersionsNONHSAT029116.1(old version)

Sequence


>NONHSAT029116.2
GTAGATCATTTTGAACTCAATGCATAAGTACCAGCCAAGGGTGCACATCATTAAGAAGAAAGACCACACAGCCTCATTGCTCAACCTGAAGTCTGAAGAATTTAGAACTTTCATCCTTCCAGAAACAGTTTTTACGGCAGTCACTGCCTACCAGAATAGATAACGAAGCTGAAAATAGATAGCAATCCTTTTGCCAAAGGATTCTGGGATTCCTCCAGGCTCACTGACCTTGAGGGAAAGTGTGGAGAGCCTGATTCAAAAGCATTCCAATGCACCTTCACCCATCCGTACCTATGGAGGAGAAGAAGATGTCTTGGGGGATGAGAGTCAGACAACCCCAAATCGTCAGCCTTTACAACATCTGATAATTTGTCTCTCAGCTCCTGGGTATCATCTTCTTCCAGTTTTCCTGGGTTTCAGCACCCACAGTCCCTGACTGCTCTTGGCACCAGCACAGCATCCATAGCAACACCCATTCCTCACCCCATCCAGGGTTCTCTGCCGCCATATAGCCGACTGGGAATGCCTTTGACCCCATCGGCCATTGCCAGCTCCATGCAAGGGAGTGGCCCCACATTCCCTTCATTCCACATGCCGCGATACCATCACTATTTTCAGCAGGGGCCCTATGCTGCCATTCAAGGACTACGCCATTCCTCTGCTGTGATGATGCCATTTG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00.1603760.0563690.08967490001.37596
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0000.07606210000.343788
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00.4316662.0841200.6511750.15743900
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
000012.1787
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
6.416340016.07260
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000543539
NONCODEv4NONHSAT029116
lncipedialnc-DPY19L2-4-1
PMID26117828PNCT_HSA024765