An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT029575.1

General info


NONCODE TRANSCRIPT IDNONHSAT029575.1
NONCODE Gene IDNONHSAG011738.1
Chromosomechr12
Start Site76699676
End Site76699949
Strand-
Exon Number1
CNCI Score-0.0856338
Length273
Assemblyhg19
Other transcript VersionsNONHSAT029575.2

Sequence


>NONHSAT029575.1
gcaaaccctaaggtgcctctgttgctggggtcactcctgcttagatttcctggtcccactaaactctcaatccacctcacattccacttcttatggttcttctcttctctctgttactgtccaacaggttcttcctgcccactgcaaaacaaaatcaattcatagagaccatggcattgcagtaaagaaagagtttaattgacacgacgccagccacgccatgtgggagacagagttattacttaaatcaatctcaccaaagaatcagaggtt

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT029575
lncipedialnc-BBS10-2-1_dup1
PMID23818866FPKM1_group_6611_transcri