An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT030059.1

General info


NONCODE TRANSCRIPT IDNONHSAT030059.1
NONCODE Gene IDNONHSAG011991.1
Chromosomechr12
Start Site96453801
End Site96454153
Strand-
Exon Number1
CNCI Score-0.1199271
Length352
Assemblyhg19
Other transcript VersionsNONHSAT030059.2

Sequence


>NONHSAT030059.1
ATGGGCAGAATTTTCCTTGATCATATCGGTGGTACCTGTCTGTGTTCCTGTGCAAACTGACATGATCCTGACCAACCGCCCAGAACTCATCTCCACTCAGTTCACAGGCGCCCTGGCCTTTTAACAAGGTCGTTAACCTGCTGTGCAGTGAACTTTAAGATCTGGTCATGCTCACTGGCAGCCACAGGGTTCAAGATGTGAGCTGCAAAAGTTGCAATAGCAAACCGGGGTGGATTTATGAATTTGCCACTGGAGATAGCCATGTTATAAGGAAGGCTGTGTGATCCTGGAAAGTGCTGAAGTTCAAGAGAGTGAAGGCTCTGAGGAGCATGTATCATCTGATAATTCTTGA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000547227
lncipedialnc-LTA4H-2-1_dup1
NONCODEv4NONHSAT030059