An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT030777.2

General info


NONCODE TRANSCRIPT IDNONHSAT030777.2
NONCODE Gene IDNONHSAG012319.2
Chromosomechr12
Start Site111923710
End Site111924239
Strand+
Exon Number1
CNCI Score-0.0819200
Length529
Assemblyhg38
Other transcript VersionsNONHSAT030777.1(old version)

Sequence


>NONHSAT030777.2
gggattacaggcgtgagccatggtgcccggccaatgatgacttcttagagacaataccaaaaaagcatgatccatgaaagaaaaaaatgataagttggacttcaataacattttaaaaatctgctctgtcaaagacactgttaagagaatgaaaggacaagcaatagactgagagaaaatatttcaaaaatacatatatgataaaagatttgtacctaaatatacaaagaactcttaaaactcaaaaagaaaataatccaatttaaaaaggggcaaaagatctgaccagacaccttaccaaagatatgcagatggcaaataagcacataaaaagattctcaatatcatatgacattagggaattgcaaaacgaggccaggtgcagtggctcacatctgtaatcccagcactttgggaggccgaggcgggcagatcaggaggtcatgagattgagatcatcctggctaacatggcgaaaccacgtctctactaaaaatacaaaaaattagccaggcatggtagcacatga

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
000.05863690.3717490.02952570
foreskinheartheart_RHLF_1HLF_2kidney
0000.16581500
liverliver_RlunglymphNodeovaryplacenta_R
00000.02598980
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
01.904380014.5965
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
15.1550013.3540
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
lncipedialnc-MAPKAPK5-3-1_dup1
NONCODEv4NONHSAT030777
PMID23818866FPKM1_group_7143_transcri