An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT031540.2

General info


NONCODE TRANSCRIPT IDNONHSAT031540.2
NONCODE Gene IDNONHSAG012590.3
Chromosomechr12
Start Site122865334
End Site122867021
Strand+
Exon Number2
CNCI Score-0.0696320
Length482
Assemblyhg38
Other transcript VersionsNONHSAT031540.1(old version)

Sequence


>NONHSAT031540.2
AATAATTCTCTATTTATTAAAAAGGGTCCTACAGCTTTACAGCCACAGCACCGGACACGGCCCTGGACAGCGACGGCGAGCCCGGCCAGGGGCCGCTTTGCAACTTCAATGCCAAGCTCACGTCTGGCTGCGACCGTGGCAGGCTGTGGCATCCCCGACAGCGGCCGGTGGCGGAGACACATAGGACTGTCTTTCGAAAATAAAATAAGTATCATGAACCATGCTCATTAAATAAAGCTGCAACAGAAGGACCACGATTCTAAATGGGACTGGGGGAGAGGCCTATTTCTTCCCAAACATGAGTTCATCAACGCTAAGATACTTAGAAATCACACGGATAATGCAAACCGATGCAACGCACAGGTGTCAGGCTGTAACCCGGCACACACAACTGCCTTGATGCCCAAAGCCTGGGCTCCTACTACTCACCACTGACCTACAGTTCTAAAATCAGACAGACACGCTGGCCCAGGGCCCCAGAG

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
0000.1407322.29093e-070
foreskinheartheart_RHLF_1HLF_2kidney
00.1311040000
liverliver_RlunglymphNodeovaryplacenta_R
00.1737630.091728503.94021e-084.32693e-08
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.18809600
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00000
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
00000
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset